Search the web
Sign In
New User? Sign Up
Browse Groups about Cloning

Top > Science > Biology > Genetics > Cloning

1 - 10 of 77   First  |  < Previous  |  Next >  |  Last

Group Listings

1 laboboes
36 Members, Archives: Membership required
ATCGTGATACAGATACAGGTGATACAGAGAATAGACAGATAGAGATAGAGAGGGATACAGATACCCCCCAGATACCCATAGACCCAGATACAGATATTAGACAGATGACAGAGATACACA
 
2 camibericos
71 Members, Archives: No Archive
A new email list for camibericos
 
3 humancloning
371 Members, Archives: Membership required
A discussion forum about human cloning, reproductive cloning and related cloning breakthroughs. The politics, science, ethics, problems, issues and related topics. We welcome all ...(more)
4 Human_Cloning
206 Members, Archives: Membership required
A group to come and discuss human cloning. Doesn't matter if you're for it, against, or kind of inbetween, if you want to talk about it, this is the place!
5 martin_maguire_fan_club
22 Members, Archives: Public
This fan club is dedicated to the worship of the wonderful, brilliant, sweet, funny, cute, lovable, and extremely talented Martin Maguire. He has lots of fans (other silly girlies like ...(more)
 
6 humancloningclub
72 Members, Archives: Public
This may be a reality. There are already major discussions. What's your opinion?
 
7 bioderGDO
40 Members, Archives: Public
Biyologlar Derneðinin Aðustos-eylül 2005 'de organize etmeyi düþündüðü çalýþtay programý için oluþturulmuþtur. Çalýþtay programý; 1) Güvenilir Gýdalar ve Gýda ...(more)
 
8 checyl_sweetgirl
40 Members, Archives: Membership required
I want to know about the science and technology and beside that I want to know specially about cloning.
 
9 clonation
37 Members, Archives: Public
Clonation
 
10 real_mythical_creatures
39 Members, Archives: Membership required
This group is about gene splicing taking genes from other animals and putting them in other animals to make unknown creatures
 
1 - 10 of 77   First  |  < Previous  |  Next >  |  Last

Copyright © 2009 Yahoo! Inc. All rights reserved.
Privacy Policy - Terms of Service - Guidelines - Help